Accessing the Degradation of RNA Using RT-qPCR by Comparing Amplifications of Short to Long Fragments
By Ann LaJuan Bohannon-Stewart
Department of Biological Sciences, Tennessee State University
Class: Biology 5110 Research in Biology
Professor: Dr. B. Washington
Date Due: 4-29-11
Semester: Spring 2011
Abstract
RNA quality has a profound influence on the validity and reliability of quantitative PCR results. Therefore, the verification of RNA integrity prior to applications like RT-qPCR and microarrays is indispensable. RNA degradation is one of the major quality factors that influence RT-qPCR microarray assay results. It is often assessed with electrophoresis. However, this method is tedious, requires extreme care, additional equipment and expensive reagent. To circumvent these obstacles, we are developing an RT-qPCR based method which can be performed by any lab equipped with qPCR instrument without the need of additional instrumentation and reagent. This RT-qPCR approach is based on the assumption that RNA breaks at random and the point of breakage follows Poisson distribution. A longer RNA molecule is more likely to break than shorter ones. Therefore, more short templates are available for PCR amplification than long ones in a somewhat degraded RNA sample. To test this approach, intact and degraded total RNA samples were prepared an RNeasy kit, amplified with two sets of primers targeting GAPDH transcripts. One set of the primers was used to amplify a 400-bp fragment and the other 64-bp fragment within the 400-bp region. Each RNA sample was amplified simultaneously with both primer sets in separate tubes. Results indicate that this approach can distinguish among RNA samples at various levels of degradation.
Introduction
Degradation of RNA in diagnostic specimens can cause false-negative or positive test results and potential misdiagnosis when lab tests that rely on the detection and quality of specific RNA sequences. RNA quality and degradation influence the analysis results of gene expression profiles in PCR, microarray, and other lab tests.1 Traditionally, agarose gel electrophoresis is used to test RNA degradation in the lab.5 But this method is time consuming and difficult to perform. Specific instruments such as Experion (BioRad)4 or Bioanalyzer (Agilent)6 have been developed to assess RNA degradation more precisely.5 However, these types of instruments requires more expenses.4 Some laboratories, especially small beginning laboratories, may not be equipped with this type of instrument. In addition, some of the quality issue may not be detected with Experion10 or Bioanalyzer,9 such as the existence of certain enzyme inhibitors.4,6
We are developing RT-qPCR based methods to assess RNA quality. Because RT-PCR based methods employ the same principles and supplies of regular RT-qPCR experiments,5 it has added advantage of close mimicking the reaction conditions, with a minimal additional cost. Here, we present a preliminary experiment to assess RNA degradation. This experiment serves as a proof of concept of a method that employs two sets of primers, respectively targeting a short and a long segment. Theoretically, longer RNA molecules are more susceptible to degradation than shorter ones.1,2,3 Thus, in a somewhat degraded RNA sample, there would be more available shorter templates than the longer ones. In RT-PCR results, this will be reflected by the number of threshold cycles.
In this report, we describe a preliminary study using GAPDH as a template. RNA samples that were degraded to various degrees were generated, assessed using Experion instrument, and then tested with RT-qPCR method. Results suggest that this method may be feasible. It could be a useful technique to labs that work with limited resources.
Materials & Method
To generate RNA, 30mg samples that were degraded at various extents, a frozen liver tissue sample was broken into five parts, left at room temperature for 0, 1, 2, 4, 24 h, and then used for RNA extraction. RNA was also extracted from other liver samples. All RNA extractions were done using Qiagen Mini Tissue kit.
Two pairs of GAPDH primers were designed on Primer Express 2.0 (Applied bBiosystems) to amplify a shorter fragment of 64-bp, and a longer fragment of 400-bp, respectively (Table 1). The 64-bp primer fragment was inside the larger 400-bp fragment. Primers were purchased through Invitrogen.
RNA concentrations were measured using a Nanodrop spectrophotometer, and tested with Experion, using Bio-Rad kit following the protocol recommended by the manufacturer. An intact RNA sample was diluted to 200, 100, 50, 25, 6.25, 1.56, 0.39, 0.97 ng/ul and used to generate standard curve. Each individual RNA sample was diluted to 25ng/ml.
Using a One-Step RT-qPCR Kit Qiagen kit, RT-qPCR tests were performed with iCycler (Bio-Rad). Standards and all samples using both GAPDH primers were PCR tested in a 96 well plates (4 wells per sample, 2 wells per standards).
Table 1: Primers used in RT-qPCR analysis
The primer sequences for 64-bp shorter fragment:
Name: cGAPDH-728F
Sequence: GAAGCTTACTGGAATGGCTTTCC
Name: cGAPDH-792R
Sequence: GGCAGGTCAGGTCAACAACA
The primer sequences for 400-bp longer fragment:
Name: cGAPDH-646F
Sequence: ACAGAGGTGCTGCCCAGAAC
Name: cGAPDH-1046R
Sequence: TGCCATGTGGACCATCAAGT
Results
The Experion test 1 shows RNA liver samples that had very little degradation with high RQI numbers (Fig 1). The Experion test 2 results shows RNA that had high amounts of degradation with low RQI numbers. Test 2 demonstrated the longer a tissue sample was left thawed at room temperature before extraction, the more degraded the RNA was after extraction.

Figure 1. Experion test comparison of High RQI vs Low RQI numbers
Experion Test 1 Lanes 1-12 were taken from several different chickens at 0 hours thawed. Experion Test 2 Lanes was from a single chicken liver. 1-4 thawed for 0 hours, Lanes 5-6 thawed for 1 hour, Lanes 7-10 thawed for 4 hours, Lanes 11-12 thawed at 24 hours
Several diagnostic RTq-PCR tests were performed on the RNA samples. The samples that had RQI numbers below 6.3 on Experion did not show any product for the long 400 bp fragment because some samples were too degraded. Therefore, we could not compare some of the products of short fragments vs. the long fragments on all samples.
There were three samples in the RT-qPCR that did show product. These samples had RQI numbers of 9.9 (sample 1), 8.9 (sample 2) and 6.3 (sample 3). Mean Ct values were subtracted to get the differences (Fig. 2) in template availability levels from long to short fragments and compared to their RQI.

Figure 2. Difference in threshold cycles between long and short amplified Fragments
RQI numbers from Experion test shows the amount of degradation of the RNA (X axis) compared to the mean Ct difference (Y axis) between base pair products of long (400-bp) and short (64-bp) RTq-PCR.
Discussion and Conclusion:
When threshold cycle of the short fragment amplification is compared with that of the long fragment amplification from the same sample, the more degraded the RNA sample is, the greater the difference is between the Ct means. The longer and the shorter base pair amplification products works, but if there is too much degradation long bp fragments may not show product levels in the RTq-PCR results. This demonstrates the amplification method is a possible method for testing RNA degradation in laboratory, but it can be difficult to get readable results, and although this method is less costly, Experion (BioRad) or Bioanalyzer (Agilent) seem to assess RNA degradation more precisely. (Fig 3) This gives you RNA Area, Concentration, Ratio (28S/18S), and RQI.4

Figure 3 Reading Experion Results
Computer generated Experion results of RNA Area, concentration, Ratio (28S/18S), and RQI on samples: single chicken liver. 1-4 thawed for 0 hours, Lanes 5-6 thawed for 1 hour, Lanes 7-10 thawed for 4 hours, Lanes 11-12 thawed at 24 hours

Figure 4 Comparing RNA Ladders and StdSens Chip
Comparison of RNA separation on automated systems. Upper panel (A) Experion RNA ladder separated on a RNA StdSens Chip(C) Lower panel (B) is a competitors electrophoresis system RNA ladder separated.
These figures should give some information why the extra expense would be worth it, if the Experion method can be afforded for RNA testing. Experion RNA ladder (Fig. 4A) separated on graph is displayed when using Experion software compared to a Electrophoresis system (Fig. 4B) shows Experion RNA ladder provides more uniform peak heights (fluorescence intensities), resulting in improved quantitation, but as you can see the Experion StdSens chip (Fig. 4C) only lets you test 12 samples at a time. Still Experion is a easier and more accurate way of testing RNA for degradation.4,10
The testing of threshold cycle of short fragment amplification vs long fragment amplification could possibly be improved if the long bp fragment was shorter. Also improvements could be more feasible if the RNA degradation is not to the lower extreme of what was presented in this study. This study should be repeated with different lengths of bp primer amplification.
Additional note:
If you would like to see videos I have personally made of how to perform the Experion procedure, click on the links below and watch the videos I have made.
Experion Computerized Electrophorisis Gel http://www.youtube.com/watch?v=4cXAYQhDobo&feature=channel_video_title
Experion example for Genomics Class http://www.youtube.com/watch?v=CZwwNs1tSQw&feature=relmfu
Dr. Washington….This can give more insight on how to read Experion results that you can give to your students to teach them how to do the test or I’ll be glad to show them the test too if any of your students want to learn it.
References
1.Simone Fleige and Michael W. Pfaffl (April-June 2006, Pages 126-139) Molecular Aspects of Medicine, Volume 27,RNA integrity and the effect on the real-time qRT-PCR performance Molecular Aspects of Medicine, Volume 27, Issues 2-3, April-June 2006, Pages 126-139
2.Zuker, M., and Stiegler, P. (1981). Optimal computer folding of large RNA sequences using thermodynamics and auxiliary Genetic and biochemical dissection of Res. 9, 133–148.
3. Wang, H.W. and Noland C, Structural basis of microRNA length variety Nucleic Acids Res January 2011: 257-268.Structural insights into RNA processing by the human RISC-loading complex. Nat. Struct. Mol. Biol. 2009;16:1148-1153.
4. Bio-Rad Experion Analysis Booklet and Software. Pg 19-28 Website: www.bio-rad.com
5. Bruns, David E., Ashwood E. R., Burtis, Carl A. Fundamentals of molecular diagnostics http://books.google.com/books?id=gselc81U5W8C&pg=PA78&lpg=PA78&dq=pcr+product+find+variants&source=bl&ots=vV8cm7uwPH&sig=htmiiDsC7Zsfphbzl9RRDuyYtm8&hl=en&ei=KxzATfLRHIiFtgeR-b2wBQ&sa=X&oi=book_result&ct=result&resnum=9&ved=0CDsQ6AEwCA#v=onepage&q&f=false 2007 Sections I, II & III, chapters 1-10
6. Diaz E, Barisone GA. DNA microarrays: sample quality control, array hybridization and scanning. J Vis Exp. 2011 Mar 15;(49). pii: 2546. doi: 10.3791/2546
7. Qiagen molecular diagnostics Sample and Assay Tech http://www.qiagen.com/products/bylabfocus/mdx/default.aspx
8. Invitrogen http://www.invitrogen.com
9. AB Applied Biosystems http://www.ambion.com/techlib/basics/rtpcr/index.html
10. GQ Experion HighSens and RNA StdSens Analysis Kits http://www.gene-quantification.de/Experion_Bulletin_3170.pdf
Department of Biological Sciences, Tennessee State University
Class: Biology 5110 Research in Biology
Professor: Dr. B. Washington
Date Due: 4-29-11
Semester: Spring 2011
Abstract
RNA quality has a profound influence on the validity and reliability of quantitative PCR results. Therefore, the verification of RNA integrity prior to applications like RT-qPCR and microarrays is indispensable. RNA degradation is one of the major quality factors that influence RT-qPCR microarray assay results. It is often assessed with electrophoresis. However, this method is tedious, requires extreme care, additional equipment and expensive reagent. To circumvent these obstacles, we are developing an RT-qPCR based method which can be performed by any lab equipped with qPCR instrument without the need of additional instrumentation and reagent. This RT-qPCR approach is based on the assumption that RNA breaks at random and the point of breakage follows Poisson distribution. A longer RNA molecule is more likely to break than shorter ones. Therefore, more short templates are available for PCR amplification than long ones in a somewhat degraded RNA sample. To test this approach, intact and degraded total RNA samples were prepared an RNeasy kit, amplified with two sets of primers targeting GAPDH transcripts. One set of the primers was used to amplify a 400-bp fragment and the other 64-bp fragment within the 400-bp region. Each RNA sample was amplified simultaneously with both primer sets in separate tubes. Results indicate that this approach can distinguish among RNA samples at various levels of degradation.
Introduction
Degradation of RNA in diagnostic specimens can cause false-negative or positive test results and potential misdiagnosis when lab tests that rely on the detection and quality of specific RNA sequences. RNA quality and degradation influence the analysis results of gene expression profiles in PCR, microarray, and other lab tests.1 Traditionally, agarose gel electrophoresis is used to test RNA degradation in the lab.5 But this method is time consuming and difficult to perform. Specific instruments such as Experion (BioRad)4 or Bioanalyzer (Agilent)6 have been developed to assess RNA degradation more precisely.5 However, these types of instruments requires more expenses.4 Some laboratories, especially small beginning laboratories, may not be equipped with this type of instrument. In addition, some of the quality issue may not be detected with Experion10 or Bioanalyzer,9 such as the existence of certain enzyme inhibitors.4,6
We are developing RT-qPCR based methods to assess RNA quality. Because RT-PCR based methods employ the same principles and supplies of regular RT-qPCR experiments,5 it has added advantage of close mimicking the reaction conditions, with a minimal additional cost. Here, we present a preliminary experiment to assess RNA degradation. This experiment serves as a proof of concept of a method that employs two sets of primers, respectively targeting a short and a long segment. Theoretically, longer RNA molecules are more susceptible to degradation than shorter ones.1,2,3 Thus, in a somewhat degraded RNA sample, there would be more available shorter templates than the longer ones. In RT-PCR results, this will be reflected by the number of threshold cycles.
In this report, we describe a preliminary study using GAPDH as a template. RNA samples that were degraded to various degrees were generated, assessed using Experion instrument, and then tested with RT-qPCR method. Results suggest that this method may be feasible. It could be a useful technique to labs that work with limited resources.
Materials & Method
To generate RNA, 30mg samples that were degraded at various extents, a frozen liver tissue sample was broken into five parts, left at room temperature for 0, 1, 2, 4, 24 h, and then used for RNA extraction. RNA was also extracted from other liver samples. All RNA extractions were done using Qiagen Mini Tissue kit.
Two pairs of GAPDH primers were designed on Primer Express 2.0 (Applied bBiosystems) to amplify a shorter fragment of 64-bp, and a longer fragment of 400-bp, respectively (Table 1). The 64-bp primer fragment was inside the larger 400-bp fragment. Primers were purchased through Invitrogen.
RNA concentrations were measured using a Nanodrop spectrophotometer, and tested with Experion, using Bio-Rad kit following the protocol recommended by the manufacturer. An intact RNA sample was diluted to 200, 100, 50, 25, 6.25, 1.56, 0.39, 0.97 ng/ul and used to generate standard curve. Each individual RNA sample was diluted to 25ng/ml.
Using a One-Step RT-qPCR Kit Qiagen kit, RT-qPCR tests were performed with iCycler (Bio-Rad). Standards and all samples using both GAPDH primers were PCR tested in a 96 well plates (4 wells per sample, 2 wells per standards).
Table 1: Primers used in RT-qPCR analysis
The primer sequences for 64-bp shorter fragment:
Name: cGAPDH-728F
Sequence: GAAGCTTACTGGAATGGCTTTCC
Name: cGAPDH-792R
Sequence: GGCAGGTCAGGTCAACAACA
The primer sequences for 400-bp longer fragment:
Name: cGAPDH-646F
Sequence: ACAGAGGTGCTGCCCAGAAC
Name: cGAPDH-1046R
Sequence: TGCCATGTGGACCATCAAGT
Results
The Experion test 1 shows RNA liver samples that had very little degradation with high RQI numbers (Fig 1). The Experion test 2 results shows RNA that had high amounts of degradation with low RQI numbers. Test 2 demonstrated the longer a tissue sample was left thawed at room temperature before extraction, the more degraded the RNA was after extraction.
Figure 1. Experion test comparison of High RQI vs Low RQI numbers
Experion Test 1 Lanes 1-12 were taken from several different chickens at 0 hours thawed. Experion Test 2 Lanes was from a single chicken liver. 1-4 thawed for 0 hours, Lanes 5-6 thawed for 1 hour, Lanes 7-10 thawed for 4 hours, Lanes 11-12 thawed at 24 hours
Several diagnostic RTq-PCR tests were performed on the RNA samples. The samples that had RQI numbers below 6.3 on Experion did not show any product for the long 400 bp fragment because some samples were too degraded. Therefore, we could not compare some of the products of short fragments vs. the long fragments on all samples.
There were three samples in the RT-qPCR that did show product. These samples had RQI numbers of 9.9 (sample 1), 8.9 (sample 2) and 6.3 (sample 3). Mean Ct values were subtracted to get the differences (Fig. 2) in template availability levels from long to short fragments and compared to their RQI.
Figure 2. Difference in threshold cycles between long and short amplified Fragments
RQI numbers from Experion test shows the amount of degradation of the RNA (X axis) compared to the mean Ct difference (Y axis) between base pair products of long (400-bp) and short (64-bp) RTq-PCR.
Discussion and Conclusion:
When threshold cycle of the short fragment amplification is compared with that of the long fragment amplification from the same sample, the more degraded the RNA sample is, the greater the difference is between the Ct means. The longer and the shorter base pair amplification products works, but if there is too much degradation long bp fragments may not show product levels in the RTq-PCR results. This demonstrates the amplification method is a possible method for testing RNA degradation in laboratory, but it can be difficult to get readable results, and although this method is less costly, Experion (BioRad) or Bioanalyzer (Agilent) seem to assess RNA degradation more precisely. (Fig 3) This gives you RNA Area, Concentration, Ratio (28S/18S), and RQI.4
Figure 3 Reading Experion Results
Computer generated Experion results of RNA Area, concentration, Ratio (28S/18S), and RQI on samples: single chicken liver. 1-4 thawed for 0 hours, Lanes 5-6 thawed for 1 hour, Lanes 7-10 thawed for 4 hours, Lanes 11-12 thawed at 24 hours
Figure 4 Comparing RNA Ladders and StdSens Chip
Comparison of RNA separation on automated systems. Upper panel (A) Experion RNA ladder separated on a RNA StdSens Chip(C) Lower panel (B) is a competitors electrophoresis system RNA ladder separated.
These figures should give some information why the extra expense would be worth it, if the Experion method can be afforded for RNA testing. Experion RNA ladder (Fig. 4A) separated on graph is displayed when using Experion software compared to a Electrophoresis system (Fig. 4B) shows Experion RNA ladder provides more uniform peak heights (fluorescence intensities), resulting in improved quantitation, but as you can see the Experion StdSens chip (Fig. 4C) only lets you test 12 samples at a time. Still Experion is a easier and more accurate way of testing RNA for degradation.4,10
The testing of threshold cycle of short fragment amplification vs long fragment amplification could possibly be improved if the long bp fragment was shorter. Also improvements could be more feasible if the RNA degradation is not to the lower extreme of what was presented in this study. This study should be repeated with different lengths of bp primer amplification.
Additional note:
If you would like to see videos I have personally made of how to perform the Experion procedure, click on the links below and watch the videos I have made.
Experion Computerized Electrophorisis Gel http://www.youtube.com/watch?v=4cXAYQhDobo&feature=channel_video_title
Experion example for Genomics Class http://www.youtube.com/watch?v=CZwwNs1tSQw&feature=relmfu
Dr. Washington….This can give more insight on how to read Experion results that you can give to your students to teach them how to do the test or I’ll be glad to show them the test too if any of your students want to learn it.
References
1.Simone Fleige and Michael W. Pfaffl (April-June 2006, Pages 126-139) Molecular Aspects of Medicine, Volume 27,RNA integrity and the effect on the real-time qRT-PCR performance Molecular Aspects of Medicine, Volume 27, Issues 2-3, April-June 2006, Pages 126-139
2.Zuker, M., and Stiegler, P. (1981). Optimal computer folding of large RNA sequences using thermodynamics and auxiliary Genetic and biochemical dissection of Res. 9, 133–148.
3. Wang, H.W. and Noland C, Structural basis of microRNA length variety Nucleic Acids Res January 2011: 257-268.Structural insights into RNA processing by the human RISC-loading complex. Nat. Struct. Mol. Biol. 2009;16:1148-1153.
4. Bio-Rad Experion Analysis Booklet and Software. Pg 19-28 Website: www.bio-rad.com
5. Bruns, David E., Ashwood E. R., Burtis, Carl A. Fundamentals of molecular diagnostics http://books.google.com/books?id=gselc81U5W8C&pg=PA78&lpg=PA78&dq=pcr+product+find+variants&source=bl&ots=vV8cm7uwPH&sig=htmiiDsC7Zsfphbzl9RRDuyYtm8&hl=en&ei=KxzATfLRHIiFtgeR-b2wBQ&sa=X&oi=book_result&ct=result&resnum=9&ved=0CDsQ6AEwCA#v=onepage&q&f=false 2007 Sections I, II & III, chapters 1-10
6. Diaz E, Barisone GA. DNA microarrays: sample quality control, array hybridization and scanning. J Vis Exp. 2011 Mar 15;(49). pii: 2546. doi: 10.3791/2546
7. Qiagen molecular diagnostics Sample and Assay Tech http://www.qiagen.com/products/bylabfocus/mdx/default.aspx
8. Invitrogen http://www.invitrogen.com
9. AB Applied Biosystems http://www.ambion.com/techlib/basics/rtpcr/index.html
10. GQ Experion HighSens and RNA StdSens Analysis Kits http://www.gene-quantification.de/Experion_Bulletin_3170.pdf

<< Home